| Basic information from miRBase |
| hairpin accession number: MI0000639 |
| Located between position 92545075 and 92545173 on chromosome 13 strand - |
| Overlapping with sense strand of Q91Y79_RAT (intron 7). |
| (Ensemble: ENSRNOT00000005467) |
| mature miRNAs for MI0000639: |
| rno-miR-350 (MIMAT0000604): TTCACAAAGCCCATACACTTTCAC |
| You can find this miRNA in ENTREZGENE: Mir350 (accession: 100313985) |
| References |
| [1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" |
| [2]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat" |