| Basic information from miRBase |
| hairpin accession number: MI0001656 |
| Located between position 65914948 and 65915033 on chromosome 10 strand + |
| mature miRNAs for MI0001656: |
| rno-miR-365* (MIMAT0017184): GAGGGACTTTCAGGGGC |
| rno-miR-365 (MIMAT0001549): TAATGCCCCTAAAAATCCTTAT |
| You can find this miRNA in ENTREZGENE: Mir365 (accession: 100314252) |
| References |
| [1]Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M, Nature. 434:338-345(2005)., "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" |
| [2]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat" |