| Basic information from miRBase |
| hairpin accession number: MI0001504 |
| Located between position 5373547 and 5373630 on chromosome 4 strand - |
| mature miRNAs for MI0001504: |
| sbi-miR156a (MIMAT0001398): TGACAGAAGAGAGTGAGCAC |
| References |
| [1]Maher C, Timmermans M, Stein L, Ware D, Proc IEEE CSB :718-723(2004)., "Identifying microRNAs in plant genomes" |
| [2]Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA, PLoS Biol. 3:e13(2005)., "Sorghum genome sequencing by methylation filtration" |
| [3]Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA, Cell Res. 15:336-360(2005)., "Identification and characterization of new plant microRNAs using EST analysis" |