| Basic information from miRBase |
| hairpin accession number: MI0010869 |
| Located between position 72676204 and 72676311 on chromosome 1 strand - |
| mature miRNAs for MI0010869: |
| sbi-miR166j (MIMAT0011329): TCGGACCAGGCTTCATTCCC |
| References |
| [1]Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare, Nature. 457:551-556(2009)., "The Sorghum bicolor genome and the diversification of grasses" |