miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010879
Located between position 61071181 and 61071273 on chromosome 7 strand +
mature miRNAs for MI0010879:
         sbi-miR169n (MIMAT0011339): TAGCCAAGGATGACTTGCCTA

References
[1]Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare, Nature. 457:551-556(2009)., "The Sorghum bicolor genome and the diversification of grasses"