miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010925
Located between position 47182770 and 47183054 on chromosome 1 strand +
mature miRNAs for MI0010925:
         sbi-miR821a (MIMAT0011385): AAGTCATCAACATAAAAGTTG

References
[1]Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare, Nature. 457:551-556(2009)., "The Sorghum bicolor genome and the diversification of grasses"