miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010919
Located between position 49901016 and 49901191 on chromosome 6 strand -
mature miRNAs for MI0010919:
         sbi-miR437s (MIMAT0011379): AAAGTTAGAGAAGTTTGACTT

References
[1]Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare, Nature. 457:551-556(2009)., "The Sorghum bicolor genome and the diversification of grasses"