miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010922
Located between position 53472511 and 53472624 on chromosome 9 strand +
mature miRNAs for MI0010922:
         sbi-miR437v (MIMAT0011382): AAAGTTAGAGAAGTTTGACTT

References
[1]Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare, Nature. 457:551-556(2009)., "The Sorghum bicolor genome and the diversification of grasses"