| Basic information from miRBase |
| hairpin accession number: MI0010672 |
| Located between position 4363 and 4440 on chromosome emb|CABF01027351.1| strand - |
| mature miRNAs for MI0010672: |
| sja-miR-125b (MIMAT0010179): TCCCTGAGACTGATAATTGCTC |
| References |
| [1]Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W, PLoS One. 3:e4034(2008)., "Identification and characterization of novel microRNAs from Schistosoma japonicum" |
| [2]Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W, PLoS Negl Trop Dis. 4:e596(2010)., "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" |