| Basic information from miRBase |
| hairpin accession number: MI0015294 |
| Located between position 2236 and 2358 on chromosome emb|CABF01003857.1| strand + |
| mature miRNAs for MI0015294: |
| sja-miR-190-5p (MIMAT0016265): TGATATGTATGGGTTACTTGGTG |
| sja-miR-190-3p (MIMAT0016266): CAGTGACCAGACATATCCCT |
| References |
| [1]Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W, PLoS Negl Trop Dis. 4:e596(2010)., "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" |