| Basic information from miRBase |
| hairpin accession number: MI0015299 |
| Located between position 1637 and 1711 on chromosome emb|CABF01030669.1| strand - |
| mature miRNAs for MI0015299: |
| sja-miR-2162-5p (MIMAT0016272): AGTGAGATTGTTGCATATTTACA |
| sja-miR-2162-3p (MIMAT0016273): TATTATGCAACGTTTCACTCT |
| References |
| [1]Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W, PLoS Negl Trop Dis. 4:e596(2010)., "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" |