| Basic information from miRBase |
| hairpin accession number: MI0015284 |
| Located between position 2869 and 2946 on chromosome emb|CABF01007682.1| strand - |
| mature miRNAs for MI0015284: |
| sja-miR-2b-5p (MIMAT0016247): CGTCTCAAAGGACTGTGAGCCA |
| sja-miR-2b-3p (MIMAT0016248): TATCACAGCCCTGCTTGGGACACA |
| References |
| [1]Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W, PLoS Negl Trop Dis. 4:e596(2010)., "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" |