miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0009971
Located between position 39241676 and 39241775 on chromosome SL2.40ch06 strand -
mature miRNAs for MI0009971:
         sly-miR156a (MIMAT0009138): TTGACAGAAGATAGAGAGCAC

References
[1]Zhang J, Zeng R, Chen J, Liu X, Liao Q, Gene. 423:1-7(2008)., "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill"