miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008360
Located between position 45629356 and 45629471 on chromosome SL2.40ch06 strand -
mature miRNAs for MI0008360:
         sly-miR167 (MIMAT0007917): TGAAGCTGCCAGCATGATCTA

References
[1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening"
[2]Zhang J, Zeng R, Chen J, Liu X, Liao Q, Gene. 423:1-7(2008)., "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill"