| Basic information from miRBase |
| hairpin accession number: MI0008361 |
| Located between position 4225343 and 4225491 on chromosome SL2.40ch07 strand + |
| mature miRNAs for MI0008361: |
| sly-miR169a (MIMAT0007918): CAGCCAAGGATGACTTGCCGG |
| References |
| [1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" |