| Basic information from miRBase |
| hairpin accession number: MI0008365 |
| Located between position 41330632 and 41330753 on chromosome SL2.40ch02 strand - |
| mature miRNAs for MI0008365: |
| sly-miR171a (MIMAT0007922): TGATTGAGCCGTGCCAATATC |
| References |
| [1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" |
| [2]Zhang J, Zeng R, Chen J, Liu X, Liao Q, Gene. 423:1-7(2008)., "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" |