| Basic information from miRBase |
| hairpin accession number: MI0008368 |
| Located between position 2882790 and 2882901 on chromosome SL2.40ch12 strand + |
| mature miRNAs for MI0008368: |
| sly-miR171d (MIMAT0007925): TTGAGCCGCGCCAATATCAC |
| References |
| [1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" |