| Basic information from miRBase |
| hairpin accession number: MI0008351 |
| Located between position 54623283 and 54623496 on chromosome SL2.40ch08 strand + |
| mature miRNAs for MI0008351: |
| sly-miR1916 (MIMAT0007908): ATTTCACTTAGACACCTCAA |
| References |
| [1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" |