| Basic information from miRBase |
| hairpin accession number: MI0008353 |
| Located between position 62590541 and 62590690 on chromosome SL2.40ch08 strand - |
| mature miRNAs for MI0008353: |
| sly-miR1918 (MIMAT0007910): TGTTGGTGAGAGTTCGATTCTC |
| References |
| [1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" |