| Basic information from miRBase |
| hairpin accession number: MI0008355 |
| Located between position 53789899 and 53790042 on chromosome SL2.40ch08 strand + |
| mature miRNAs for MI0008355: |
| sly-miR1919b (MIMAT0007912): ACGAGAGTCATCTGTGACAGG |
| References |
| [1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" |