miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008371
Located between position 63282726 and 63282841 on chromosome SL2.40ch07 strand -
mature miRNAs for MI0008371:
         sly-miR397 (MIMAT0007928): ATTGAGTGCAGCGTTGATGA

References
[1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening"