Basic information from miRBase |
hairpin accession number: MI0010941 |
Located between position 35249 and 35345 on chromosome Contig3339 strand + |
mature miRNAs for MI0010941: |
sme-miR-2147d-5p (MIMAT0011406): CGGAAAACTCGCACCGTGATAT |
sme-miR-2147d-3p (MIMAT0011407): TTTCACTGCGACTGTTCCCAT |
References |
[1]Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR, RNA. 15:1483-1491(2009)., "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" |