| Basic information from miRBase |
| hairpin accession number: MI0010950 |
| Located between position 3412 and 3483 on chromosome Contig43306 strand + |
| mature miRNAs for MI0010950: |
| sme-miR-2203* (MIMAT0011419): ACGAAGGCTTAATGATTATCAT |
| sme-miR-2203 (MIMAT0011420): ATCAAGATCGTTAGTAAGTT |
| References |
| [1]Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR, RNA. 15:1483-1491(2009)., "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" |