| Basic information from miRBase |
| hairpin accession number: MI0010937 |
| Located between position 12347 and 12426 on chromosome Contig5212 strand - |
| mature miRNAs for MI0010937: |
| sme-miR-2204-5p (MIMAT0011398): TGAAATTAGGACGGAAATTACAC |
| sme-miR-2204-3p (MIMAT0011399): AAACATCCGGACTAAGTTTAT |
| References |
| [1]Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR, RNA. 15:1483-1491(2009)., "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" |