| Basic information from miRBase |
| hairpin accession number: MI0010940 |
| Located between position 14529 and 14586 on chromosome Contig12996 strand - |
| mature miRNAs for MI0010940: |
| sme-miR-753d-5p (MIMAT0011404): CAGGGCTTGGATTGTGATCTC |
| sme-miR-753d-3p (MIMAT0011405): AGATCATTATTCAAGCTCTCT |
| References |
| [1]Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR, RNA. 15:1483-1491(2009)., "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" |