| Basic information from miRBase |
| hairpin accession number: MI0017984 |
| Located between position 38549760 and 38549851 on chromosome 3 strand + |
| mature miRNAs for MI0017984: |
| ssc-let-7a (MIMAT0013865): TGAGGTAGTAGGTTGTATAGTT |
| References |
| [1]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing" |