| Basic information from miRBase |
| hairpin accession number: MI0013087 |
| Located between position 28999419 and 28999498 on chromosome 13 strand + |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSSSCT00000020901) |
| mature miRNAs for MI0013087: |
| ssc-let-7g (MIMAT0013867): TGAGGTAGTAGTTTGTACAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7G (accession: 100498768) |
| References |
| [1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |
| [2]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" |