miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0010679

Located between position 103818808 and 103818888 on chromosome 6 strand +

mature miRNAs for MI0010679:

ssc-miR-101 (MIMAT0010185): TACAGTACTGTGATAACTGAA

You can find this miRNA in ENTREZGENE: MIR101A-2 (accession: 100316578)

References

[1]Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R, BMC Genomics. 10:65(2009)., "Cloning, characterization and expression analysis of porcine microRNAs"

[2]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"

[3]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"