miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013101
Located between position 22389424 and 22389503 on chromosome 12 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSSSCT00000020865)
mature miRNAs for MI0013101:
         ssc-miR-10a (MIMAT0013884): TACCCTGTAGATCCGAATTTGT
You can find this miRNA in ENTREZGENE: MIR10A (accession: 100498783)

References
[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"