| Basic information from miRBase |
| hairpin accession number: MI0016619 |
| Located between position 294113069 and 294113141 on chromosome 1 strand + |
| Overlapping with sense strand of (intron 6). |
| (Ensemble: ENSSSCT00000006406) |
| mature miRNAs for MI0016619: |
| ssc-miR-126* (MIMAT0018377): CATTATTACTTTTGGTACGCG |
| ssc-miR-126 (MIMAT0018378): TCGTACCGTGAGTAATAATGCG |
| You can find this miRNA in ENTREZGENE: MIR126 (accession: 100526399) |
| References |
| [1]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" |