| Basic information from miRBase |
| hairpin accession number: MI0013144 |
| Located between position 133929738 and 133929817 on chromosome 7 strand + |
| Overlapping with antisense strand of (exon 1). |
| (Ensemble: ENSSSCT00000002858) |
| mature miRNAs for MI0013144: |
| ssc-miR-127 (MIMAT0013932): TCGGATCCGTCTGAGCTTGGCT |
| You can find this miRNA in ENTREZGENE: MIR127 (accession: 100498735) |
| References |
| [1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |