| Basic information from miRBase |
| hairpin accession number: MI0013147 |
| Located between position 119440203 and 119440282 on chromosome 14 strand - |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSSSCT00000011592) |
| mature miRNAs for MI0013147: |
| ssc-miR-1307 (MIMAT0013936): ACTCGGCGTGGCGTCGGTCGTG |
| You can find this miRNA in ENTREZGENE: MIR1307 (accession: 100498737) |
| References |
| [1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |