miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008217
Located between position 11301854 and 11301932 on chromosome 2 strand -
mature miRNAs for MI0008217:
         ssc-miR-130a (MIMAT0007758): CAGTGCAATGTTAAAAGGGCAT
You can find this miRNA in ENTREZGENE: MIR130A (accession: 100316596)

References
[1]Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS, Mamm Genome. 19:570-580(2008)., "Identification and characterization of new microRNAs from pig"
[2]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
[3]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"