| Basic information from miRBase |
| hairpin accession number: MI0017996 |
| Located between position 24490869 and 24490947 on chromosome 2 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSSSCT00000021702) |
| mature miRNAs for MI0017996: |
| ssc-miR-1343 (MIMAT0020596): CTCCTGGGGCCCGCACTCTCGC |
| References |
| [1]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing" |