miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0002419

Located between position 78787511 and 78787608 on chromosome 13 strand +

Overlapping with sense strand of (intron 5).

(Ensemble: ENSSSCT00000012842)

mature miRNAs for MI0002419:

ssc-miR-15b (MIMAT0002125): TAGCAGCACATCATGGTTTACA

You can find this miRNA in ENTREZGENE: MIR15B (accession: 100170411)

References

[1]Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L, BMC Genomics. 6:70(2005)., "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing"

[2]Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS, Mamm Genome. 19:570-580(2008)., "Identification and characterization of new microRNAs from pig"

[3]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"

[4]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"