miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0008213

Located between position 78787668 and 78787744 on chromosome 13 strand +

Overlapping with sense strand of (intron 5).

(Ensemble: ENSSSCT00000012842)

mature miRNAs for MI0008213:

ssc-miR-16 (MIMAT0007754): TAGCAGCACGTAAATATTGGCG

You can find this miRNA in ENTREZGENE: MIR16-2 (accession: 100316611)

References

[1]Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS, Mamm Genome. 19:570-580(2008)., "Identification and characterization of new microRNAs from pig"

[2]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"

[3]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"