miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0008214

Located between position 60972458 and 60972534 on chromosome 11 strand +

mature miRNAs for MI0008214:

ssc-miR-17-5p (MIMAT0007755): CAAAGTGCTTACAGTGCAGGTAG

ssc-miR-17-3p (MIMAT0015268): ACTGCAGTGAAGGCACTTGTAG

You can find this miRNA in ENTREZGENE: MIR17 (accession: 100316572)

References

[1]Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS, Mamm Genome. 19:570-580(2008)., "Identification and characterization of new microRNAs from pig"

[2]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"

[3]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"

[4]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing"