| Basic information from miRBase |
| hairpin accession number: MI0013162 |
| Located between position 58239591 and 58239670 on chromosome 7 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSSSCT00000022181) |
| mature miRNAs for MI0013162: |
| ssc-miR-1839-5p (MIMAT0013952): AAGGTAGATAGAACAGGTCTTG |
| ssc-miR-1839-3p (MIMAT0017385): AGACCTACTTTTCTACCAACA |
| You can find this miRNA in ENTREZGENE: MIR1839 (accession: 100498747) |
| References |
| [1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |
| [2]Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R, BMC Genomics. 11:275(2010)., "Deciphering the porcine intestinal microRNA transcriptome" |