miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002455
Located between position 60972593 and 60972684 on chromosome 11 strand +
mature miRNAs for MI0002455:
         ssc-miR-18a (MIMAT0002161): TAAGGTGCATCTAGTGCAGATA
You can find this miRNA in ENTREZGENE: MIR18 (accession: 100170410)

References
[1]Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L, BMC Genomics. 6:70(2005)., "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing"
[2]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
[3]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing"