Basic information from miRBase |
hairpin accession number: MI0017985 |
Located between position 108212915 and 108212997 on chromosome X strand - |
mature miRNAs for MI0017985: |
ssc-miR-18b (MIMAT0020585): TAAGGTGCATCTAGTGCAGTTAG |
References |
[1]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing" |