miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013159
Located between position 108212546 and 108212625 on chromosome X strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSSSCT00000020032)
mature miRNAs for MI0013159:
         ssc-miR-19b (MIMAT0013950): TGTGCAAATCCATGCAAAACTGA
You can find this miRNA in ENTREZGENE: MIR19B-2 (accession: 100498776)

References
[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"