miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0002423

Located between position 60972911 and 60972981 on chromosome 11 strand +

mature miRNAs for MI0002423:

ssc-miR-20 (MIMAT0002129): TAAAGTGCTTATAGTGCAGGTA

You can find this miRNA in ENTREZGENE: MIR20 (accession: 100170409)

References

[1]Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L, BMC Genomics. 6:70(2005)., "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing"

[2]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"

[3]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"