Basic information from miRBase |
hairpin accession number: MI0017999 |
Located between position 123165528 and 123165595 on chromosome 7 strand + |
mature miRNAs for MI0017999: |
ssc-miR-2476 (MIMAT0020599): TCCCTGTGGTCTAGTGGTTAG |
References |
[1]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing" |