miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002460
Located between position 127174326 and 127174413 on chromosome 9 strand +
mature miRNAs for MI0002460:
         ssc-miR-29c (MIMAT0002166): TAGCACCATTTGAAATCGGTTA
You can find this miRNA in ENTREZGENE: MIR29C (accession: 100316569)

References
[1]Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L, BMC Genomics. 6:70(2005)., "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing"
[2]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"