miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0008215

Located between position 5733584 and 5733659 on chromosome 4 strand +

mature miRNAs for MI0008215:

ssc-miR-30b-5p (MIMAT0007756): TGTAAACATCCTACACTCAGCT

ssc-miR-30b-3p (MIMAT0015269): CTGGGAGGTGGATGTTTACTT

You can find this miRNA in ENTREZGENE: MIR30B (accession: 100316573)

References

[1]Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS, Mamm Genome. 19:570-580(2008)., "Identification and characterization of new microRNAs from pig"

[2]Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R, BMC Genomics. 10:65(2009)., "Cloning, characterization and expression analysis of porcine microRNAs"

[3]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"

[4]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"