| Basic information from miRBase |
| hairpin accession number: MI0016618 |
| Located between position 121821241 and 121821320 on chromosome 6 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSSSCT00000019802) |
| mature miRNAs for MI0016618: |
| ssc-miR-30c (MIMAT0002167): TGTAAACATCCTACACTCTCAGC |
| You can find this miRNA in ENTREZGENE: MIR30C-1 (accession: 100526409) |
| References |
| [1]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" |