miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013091
Located between position 5729459 and 5729537 on chromosome 4 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSSSCT00000020352)
mature miRNAs for MI0013091:
         ssc-miR-30d (MIMAT0013871): TGTAAACATCCCCGACTGGAAGCT
You can find this miRNA in ENTREZGENE: MIR30D (accession: 100498705)

References
[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"