| Basic information from miRBase |
| hairpin accession number: MI0013092 |
| Located between position 121824301 and 121824380 on chromosome 6 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSSSCT00000021088) |
| mature miRNAs for MI0013092: |
| ssc-miR-30e-5p (MIMAT0013872): TGTAAACATCCTTGACTGGAAGCT |
| ssc-miR-30e-3p (MIMAT0013873): CTTTCAGTCGGATGTTTACAGC |
| You can find this miRNA in ENTREZGENE: MIR30E (accession: 100498760) |
| References |
| [1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |
| [2]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" |