miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008216
mature miRNAs for MI0008216:
         ssc-miR-34a (MIMAT0007757): TGGCAGTGTCTTAGCTGGTTGT
You can find this miRNA in ENTREZGENE: MIR34A (accession: 100316602)

References
[1]Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS, Mamm Genome. 19:570-580(2008)., "Identification and characterization of new microRNAs from pig"
[2]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"