| Basic information from miRBase |
| hairpin accession number: MI0013132 |
| Located between position 38328136 and 38328215 on chromosome 9 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSSSCT00000016385) |
| mature miRNAs for MI0013132: |
| ssc-miR-34c (MIMAT0013916): AGGCAGTGTAGTTAGCTGATTGC |
| You can find this miRNA in ENTREZGENE: MIR34C (accession: 100498727) |
| References |
| [1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |